ORK06305

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06305

Order Kazusa clone(s) from :

Accession No	AB209081
Product ID	ORK06305
Clone name	hk04187
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PDE4B
cDNA sequence	DNA sequence (4267 bp) Predicted protein sequence (726 aa)
Description	cAMP-specific 3',5'-cyclic phosphodiesterase 4B (EC 3.1.4.17) (DPDE4) (PDE32).

Features of the cloned cDNA sequence

Description

Length: 4267 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1901 bp
Genome contig ID	gi89161185f_66130978
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACTTTTATATGAGGTGAATAAAGAAAAGCATGATT
Flanking genome sequence (481868 - 481917)	----+--------+--------+--------+--------+----* AGATTAGTCTGTAGGCCCACTTATTTCACAATTAGTTCTGACATATGAAA

Features of the protein sequence

Description

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92318	100.0	phosphodiestera...	Homo sapiens
AAB96381	100.0	cyclic AMP spec...	Homo sapiens
XP_001091940	99.7	similar to phos...	Macaca mulatta
XP_001091579	99.0	similar to phos...	Macaca mulatta
XP_001162777	99.4	phosphodiestera...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002073	391	404	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	422	435	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	436	451	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	463	479	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	550	563	PR00387	3'5'-cyclic nucleotide phosphodiesterase
	IPR002073	567	583	PR00387	3'5'-cyclic nucleotide phosphodiesterase
HMMPfam	IPR002073	395	639	PF00233	3'5'-cyclic nucleotide phosphodiesterase
HMMSmart	IPR003607	393	568	SM00471	Metal-dependent phosphohydrolase
ScanRegExp	IPR002073	436	447	PS00126	3'5'-cyclic nucleotide phosphodiesterase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp