ORK07670

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07670

Order Kazusa clone(s) from :

Accession No	AB290159
Product ID	ORK07670
Clone name	hk06640y2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MYO16
cDNA sequence	DNA sequence (7427 bp) Predicted protein sequence (1883 aa)
Description	Homo sapiens mRNA for MYO16/KIAA0865 variant protein

Features of the cloned cDNA sequence

Description

Length: 7427 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1161 bp
Genome contig ID	gi51511729f_107979571
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAAAGTTACTGTGCCAATAAAGAGGTACAACTGTG
Flanking genome sequence (678777 - 678826)	----+--------+--------+--------+--------+----* TTCTTCTATTGTTTTTGTTGTTGTTATTATTGTCTCCCATGAACTCTTGT

Features of the protein sequence

Description

Length: 1883 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509728	98.8	myosin heavy ch...	Pan troglodytes
AAI46792	100.0	Myosin XVI [Hom...	Homo sapiens
Q9Y6X6	99.9	Myosin-XVI; Unc...	Homo sapiens
XP_001085293	94.9	similar to myos...	Macaca mulatta
XP_542665	70.3	similar to myos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	280	292	PR01415	Ankyrin
	IPR002110	292	304	PR01415	Ankyrin
	IPR001609	456	475	PR00193	Myosin head
	IPR001609	515	540	PR00193	Myosin head
	IPR001609	559	586	PR00193	Myosin head
	IPR001609	798	826	PR00193	Myosin head
HMMPfam	IPR002110	117	149	PF00023	Ankyrin
	IPR002110	150	182	PF00023	Ankyrin
	IPR002110	183	217	PF00023	Ankyrin
	IPR002110	230	245	PF00023	Ankyrin
	IPR002110	246	278	PF00023	Ankyrin
	IPR002110	279	311	PF00023	Ankyrin
	IPR001609	428	849	PF00063	Myosin head
	IPR001609	869	1158	PF00063	Myosin head
	IPR000048	1173	1193	PF00612	IQ calmodulin-binding region
HMMSmart	IPR002110	117	146	SM00248	Ankyrin
	IPR002110	150	179	SM00248	Ankyrin
	IPR002110	183	214	SM00248	Ankyrin
	IPR002110	246	275	SM00248	Ankyrin
	IPR002110	279	308	SM00248	Ankyrin
	IPR001609	423	1171	SM00242	Myosin head
ProfileScan	IPR002110	84	311	PS50297	Ankyrin
	IPR002110	117	149	PS50088	Ankyrin
	IPR002110	150	182	PS50088	Ankyrin
	IPR002110	246	278	PS50088	Ankyrin
	IPR002110	279	311	PS50088	Ankyrin
	IPR000048	1172	1201	PS50096	IQ calmodulin-binding region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp