ORK11838

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11838

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11838
Clone name	hk09638
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SREBF1
cDNA sequence	DNA sequence (4234 bp) Predicted protein sequence (1229 aa)
Description	Sterol regulatory element-binding protein 1 (SREBP-1)(Sterol regulatory element-binding transcription factor 1) [Contains Processed sterol regulatory element-binding protein 1]

Features of the cloned cDNA sequence

Description

Length: 4234 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	543 bp
Genome contig ID	gi51511734r_17556118
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GTTTTGTACAGAGAATTAAAAATGAAATTATTTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTGGGTTTTGTGTCTTCAGCTGATGGATGTGCTGACTAGTGAGAGTG

Features of the protein sequence

Description

Length: 1229 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW55691	100.0	sterol regulato...	Homo sapiens
AAH63281	99.8	Sterol regulato...	Homo sapiens
BAG52289	99.9	unnamed protein...	Homo sapiens
P36956	97.4	Sterol regulato...	Homo sapiens
AAC50051	97.3	SREBP-1 [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	406	456	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	411	461	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	404	456	PS50888	Basic helix-loop-helix dimerisation region bHLH

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	570	LALCTLVFLCLSCNPLASLLGAR	592	SECONDARY	23
SOSUI2	2	626	LLPPVVWLLNGLLVLVSLVLLFV	648	PRIMARY	23