ORK07683

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07683

Order Kazusa clone(s) from :

Accession No	AB210043
Product ID	ORK07683
Clone name	pf01047
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CREBBP
cDNA sequence	DNA sequence (7598 bp) Predicted protein sequence (2472 aa)
Description	CREB-binding protein

Features of the cloned cDNA sequence

Description

Length: 7598 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	179 bp
Genome contig ID	gi51511732r_3617541
PolyA signal sequence (AATATA,-32)	+--------+--------+----*----+---- AAGAATATATTTTTTTGTTAAAAACCAGTTGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATCTGGTCTCTCTCTTTGGTTTTTTTTTGGCGGGGGGGTGGGGGGG

Features of the protein sequence

Description

Length: 2472 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06125	100.0	CREBBP variant ...	Homo sapiens
NP_001073315	100.0	CREB binding pr...	Homo sapiens
XP_851777	95.2	similar to CREB...	Canis lupus fam...
XP_001499399	92.7	similar to CREB...	Equus caballus
Q92793	98.4	CREB-binding pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	1136	1149	PR00503	Bromodomain
	IPR001487	1152	1168	PR00503	Bromodomain
	IPR001487	1168	1186	PR00503	Bromodomain
	IPR001487	1186	1205	PR00503	Bromodomain
HMMPfam	IPR000197	416	479	PF02135	Zinc finger
	IPR003101	617	697	PF02172	Coactivator CBP
	IPR001487	1120	1210	PF00439	Bromodomain
	IPR010303	1211	1271	PF06001	Protein of unknown function DUF902
	IPR009255	1346	1583	PF06010	Transcriptional coactivation
	IPR000433	1731	1772	PF00569	Zinc finger
	IPR000197	1794	1873	PF02135	Zinc finger
	IPR014744	2046	2145	PF09030	Nuclear receptor coactivator
HMMSmart	IPR000197	416	481	SM00551	Zinc finger
	IPR001487	1114	1224	SM00297	Bromodomain
	IPR000433	1731	1772	SM00291	Zinc finger
	IPR000197	1796	1874	SM00551	Zinc finger
ProfileScan	IPR000197	415	509	PS50134	Zinc finger
	IPR003101	617	696	PS50952	Coactivator CBP
	IPR001487	1133	1205	PS50014	Bromodomain
	IPR000433	1731	1774	PS50135	Zinc finger
	IPR000197	1795	1876	PS50134	Zinc finger
ScanRegExp	IPR003439	191	205	PS00211	ABC transporter related
	IPR001487	1138	1197	PS00633	Bromodomain
	IPR000433	1737	1762	PS01357	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp