ORK11778

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11778

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11778
Clone name	pf01047s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CREBBP
cDNA sequence	DNA sequence (7712 bp) Predicted protein sequence (2510 aa)
HaloTag ORF Clone	FHC11778
Flexi ORF Clone	FXC11778
Description	CREB-binding protein

Features of the cloned cDNA sequence

Description

Length: 7712 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	179 bp
Genome contig ID	gi51511732r_3617541
PolyA signal sequence (AATATA,-32)	+--------+--------+----*----+---- AAGAATATATTTTTTTGTTAAAAACCAGTTGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATCTGGTCTCTCTCTTTGGTTTTTTTTTGGCGGGGGGGTGGGGGGG

Features of the protein sequence

Description

Length: 2510 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92793	100.0	CREB-binding pr...	Homo sapiens
AAC51770	99.9	CREB-binding pr...	Homo sapiens
XP_523285	99.9	CREB binding pr...	Pan troglodytes
XP_001095225	99.4	CREB binding pr...	Macaca mulatta
AAR23149	95.7	CREB-binding pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	1174	1187	PR00503	Bromodomain
	IPR001487	1190	1206	PR00503	Bromodomain
	IPR001487	1206	1224	PR00503	Bromodomain
	IPR001487	1224	1243	PR00503	Bromodomain
HMMPfam	IPR000197	416	500	PF02135	Zinc finger
	IPR003101	655	735	PF02172	Coactivator CBP
	IPR001487	1158	1248	PF00439	Bromodomain
	IPR010303	1249	1309	PF06001	Protein of unknown function DUF902
	IPR009255	1384	1621	PF06010	Transcriptional coactivation
	IPR000433	1769	1810	PF00569	Zinc finger
	IPR000197	1832	1911	PF02135	Zinc finger
	IPR014744	2084	2183	PF09030	Nuclear receptor coactivator
HMMSmart	IPR000197	416	501	SM00551	Zinc finger
	IPR001487	1152	1262	SM00297	Bromodomain
	IPR000433	1769	1810	SM00291	Zinc finger
	IPR000197	1834	1912	SM00551	Zinc finger
ProfileScan	IPR000197	415	501	PS50134	Zinc finger
	IPR003101	655	734	PS50952	Coactivator CBP
	IPR001487	1171	1243	PS50014	Bromodomain
	IPR000433	1769	1812	PS50135	Zinc finger
	IPR000197	1833	1914	PS50134	Zinc finger
ScanRegExp	IPR003439	191	205	PS00211	ABC transporter related
	IPR001487	1176	1235	PS00633	Bromodomain
	IPR000433	1775	1800	PS01357	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp