Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07090
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209669
Product ID ORK07090
Clone name pf02857
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TEP1
cDNA sequence DNA sequence (6694 bp)
Predicted protein sequence (1903 aa)
Description Telomerase protein component 1 (Telomerase-associated protein 1) (Telomerase protein 1) (p240) (p80 telomerase homolog).
Features of the cloned cDNA sequence

Length: 6694 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 982 bp
Genome contig ID gi51511730r_19805908
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CACTCCAGCCTGGGCAACAGAGCGAGACTCTGTCT
Flanking genome sequence
(99722 - 99673)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAACTACCCAGATGAGAGGTGAGGAGCCAAGCCAT

Features of the protein sequence

Length: 1903 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92906 0 100.0 Telomerase prot...
 Homo sapiens
Q99973 0 99.4 Telomerase prot...
 Homo sapiens
EAW66475 0 99.3 telomerase-asso...
 Homo sapiens
AAI26108 0 99.3 Telomerase-asso...
 Homo sapiens
XP_001137917 0 98.2 telomerase-asso...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 1399 1432 PD000018 WD40 repeat
FPrintScan IPR001680 1463 1477 PR00320 WD40 repeat
IPR001680 1503 1517 PR00320 WD40 repeat
IPR001680 1595 1609 PR00320 WD40 repeat
HMMPfam IPR008858 1 26 PF05731 TROVE
IPR007111 511 686 PF05729 NACHT nucleoside triphosphatase
IPR001680 1091 1129 PF00400 WD40 repeat
IPR001680 1146 1170 PF00400 WD40 repeat
IPR001680 1216 1254 PF00400 WD40 repeat
IPR001680 1344 1380 PF00400 WD40 repeat
IPR001680 1393 1431 PF00400 WD40 repeat
IPR001680 1438 1476 PF00400 WD40 repeat
IPR001680 1480 1516 PF00400 WD40 repeat
IPR001680 1519 1566 PF00400 WD40 repeat
IPR001680 1570 1608 PF00400 WD40 repeat
HMMSmart IPR001680 1006 1046 SM00320 WD40 repeat
IPR001680 1049 1087 SM00320 WD40 repeat
IPR001680 1090 1129 SM00320 WD40 repeat
IPR001680 1130 1170 SM00320 WD40 repeat
IPR001680 1173 1212 SM00320 WD40 repeat
IPR001680 1215 1254 SM00320 WD40 repeat
IPR001680 1260 1297 SM00320 WD40 repeat
IPR001680 1300 1338 SM00320 WD40 repeat
IPR001680 1343 1380 SM00320 WD40 repeat
IPR001680 1392 1431 SM00320 WD40 repeat
IPR001680 1437 1476 SM00320 WD40 repeat
IPR001680 1479 1516 SM00320 WD40 repeat
IPR001680 1518 1566 SM00320 WD40 repeat
IPR001680 1569 1608 SM00320 WD40 repeat
IPR001680 1611 1650 SM00320 WD40 repeat
IPR001680 1651 1688 SM00320 WD40 repeat
IPR001680 1701 1740 SM00320 WD40 repeat
ProfileScan IPR007111 511 772 PS50837 NACHT nucleoside triphosphatase
IPR001680 1014 1659 PS50294 WD40 repeat
IPR001680 1222 1254 PS50082 WD40 repeat
IPR001680 1399 1440 PS50082 WD40 repeat
IPR001680 1445 1485 PS50082 WD40 repeat
IPR001680 1486 1516 PS50082 WD40 repeat
IPR001680 1576 1609 PS50082 WD40 repeat
IPR001680 1618 1650 PS50082 WD40 repeat
ScanRegExp IPR001680 1074 1088 PS00678 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp