ORK04044

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04044

Order Kazusa clone(s) from :

Accession No	AB209685
Product ID	ORK04044
Clone name	pf10233
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADAMTS6
cDNA sequence	DNA sequence (6956 bp) Predicted protein sequence (530 aa)
Description	ADAMTS-6 precursor (EC 3.4.24.-) (A disintegrin and metalloproteinase with thrombospondin motifs 6) (ADAM-TS 6) (ADAM-TS6).

Features of the cloned cDNA sequence

Description

Length: 6956 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3097 bp
Genome contig ID	gi51511721r_64380322
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AATTTAGTAAAATAAAAATTCAGCTTATAATAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACAGATTGAAGTTGTCTATTCCCTGAAAAGCCTGTGTTAAACTGGTAG

Features of the protein sequence

Description

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92922	100.0	a disintegrin a...	Homo sapiens
AAI56432	100.0	ADAM metallopep...	synthetic construct
AAW47397	100.0	ADAMTS6 variant...	Homo sapiens
XP_526907	99.8	ADAM metallopep...	Pan troglodytes
XP_001084793	99.6	similar to ADAM...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	90	109	PR01857	Peptidase M12B
FPrintScan	IPR013273	110	129	PR01857	Peptidase M12B
HMMPfam	IPR010294	130	242	PF05986	ADAM-TS Spacer 1
	IPR000884	257	312	PF00090	Thrombospondin
	IPR000884	319	372	PF00090	Thrombospondin
	IPR000884	435	485	PF00090	Thrombospondin
	IPR010909	495	529	PF08686	PLAC
HMMSmart	IPR000884	256	313	SM00209	Thrombospondin
	IPR000884	315	373	SM00209	Thrombospondin
	IPR000884	376	426	SM00209	Thrombospondin
	IPR000884	434	482	SM00209	Thrombospondin
ProfileScan	IPR000884	253	313	PS50092	Thrombospondin
	IPR000884	315	373	PS50092	Thrombospondin
	IPR000884	431	486	PS50092	Thrombospondin
	IPR010909	492	530	PS50900	PLAC

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp