Length: 4765 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
892 bp |
Genome contig ID |
gi51511747f_62067670 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- AAGTGCAGGAAAAAGAACTGCACCTACACACAGGT |
Flanking genome sequence (104766 - 104815) |
----+----*----+----*----+----*----+----*----+----* GAGCGGCCGCTGGGCACCCTCCCCCGGGCCCGGTGTCTTCAGGGCATCTG |
Length: 136 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
XP_001152936 |
7.2e-12 |
75.0 |
similar to tran...
|
Pan troglodytes
|
AAH50623 |
3.1e-11 |
95.6 |
TCEA2 protein [...
|
Homo sapiens
|
CAI13200 |
3.1e-11 |
95.6 |
transcription e...
|
Homo sapiens
|
CAD11900 |
3.3e-11 |
95.6 |
transcription e...
|
Homo sapiens
|
BAG51383 |
3.3e-11 |
95.6 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR003618 |
33 |
52 |
PF07500 |
Transcription elongation factor S-II |