ORK07695

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07695

Order Kazusa clone(s) from :

Accession No	AB208832
Product ID	ORK07695
Clone name	pj00488
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIDD1
cDNA sequence	DNA sequence (3994 bp) Predicted protein sequence (680 aa)
Description	Homo sapiens mRNA for Hypothetical protein DKFZp434D229 variant protein.

Features of the cloned cDNA sequence

Description

Length: 3994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	523 bp
Genome contig ID	gi51511727r_689185
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCCCTGTGAGCAACAAAACTGCACTGTTTCTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTCAGAGCTTGATTTATTTGTTGGATGGAGAAGCCGTTGGAGGGCGGA

Features of the protein sequence

Description

Length: 680 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92069	0	100.0	Hypothetical pr...	Homo sapiens
CAD38708	0	99.6	hypothetical pr...	Homo sapiens
BAB01648	8.6e-201	91.7	unnaemd protein...	Macaca fascicularis
BAD92766	1.8e-168	94.0	leucine rich re...	Homo sapiens
AAG13461	5.4e-138	93.3	PIDD [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001611	82	103	PF00560	Leucine-rich repeat
HMMPfam	IPR001611	105	127	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	80	102	SM00369	Leucine-rich repeat
	IPR003591	103	126	SM00369	Leucine-rich repeat
	IPR000906	161	261	SM00218	ZU5
ProfileScan	IPR000906	156	263	PS51145	ZU5
ProfileScan	IPR000906	294	406	PS51145	ZU5

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp