ORK06544

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06544

Order Kazusa clone(s) from :

Accession No	AB209438
Product ID	ORK06544
Clone name	pj01450
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PWP2
cDNA sequence	DNA sequence (4564 bp) Predicted protein sequence (316 aa)
Description	Periodic tryptophan protein 2 homolog.

Features of the cloned cDNA sequence

Description

Length: 4564 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3596 bp
Genome contig ID	gi51511750f_44263468
PolyA signal sequence (None)	+--------+--------+----*----+---- TTGTCCCAGGGGAATGTACTTAATACTGTTTCTTT
Flanking genome sequence (108698 - 108747)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAAAAAAATGTTGGGAGGAATGAGCTTAAATTTT

Features of the protein sequence

Description

Length: 316 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92675	5.8e-129	100.0	PWP2 periodic t...	Homo sapiens
AAH13309	2e-74	99.4	PWP2 periodic t...	Homo sapiens
AAB08084	2e-74	99.4	PWP2H protein [...	Homo sapiens
Q15269	2e-74	99.4	Periodic trypto...	Homo sapiens
CAA64560	2e-74	99.4	PWP2 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	90	122	PD000018	WD40 repeat
	IPR001680	130	164	PD000018	WD40 repeat
	IPR001680	216	249	PD000018	WD40 repeat
FPrintScan	IPR001680	108	122	PR00320	WD40 repeat
	IPR001680	150	164	PR00320	WD40 repeat
	IPR001680	236	250	PR00320	WD40 repeat
HMMPfam	IPR001680	83	121	PF00400	WD40 repeat
	IPR001680	125	163	PF00400	WD40 repeat
	IPR001680	211	249	PF00400	WD40 repeat
HMMSmart	IPR001680	82	121	SM00320	WD40 repeat
	IPR001680	124	163	SM00320	WD40 repeat
	IPR001680	166	207	SM00320	WD40 repeat
	IPR001680	210	249	SM00320	WD40 repeat
ProfileScan	IPR001680	73	258	PS50294	WD40 repeat
	IPR001680	89	121	PS50082	WD40 repeat
	IPR001680	131	172	PS50082	WD40 repeat
	IPR001680	217	250	PS50082	WD40 repeat
ScanRegExp	IPR001680	108	122	PS00678	WD40 repeat
ScanRegExp	IPR001680	236	250	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp