Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06930
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209439
Product ID ORK06930
Clone name pj01608
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SNX15
cDNA sequence DNA sequence (4715 bp)
Predicted protein sequence (267 aa)
Description Sorting nexin-15.
Features of the cloned cDNA sequence

Length: 4715 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3910 bp
Genome contig ID gi51511727f_64451588
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTTAAGAGTCCATAAATAAAATTTGTTGGAACAC
Flanking genome sequence
(113032 - 113081)
----+----*----+----*----+----*----+----*----+----*
AACCAGGCTAATTCATTTAGTATTGTGATAGCTGCTTTCGCGCTACACTG

Features of the protein sequence

Length: 267 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92676 8.9e-98 100.0 sorting nexin 1...
Homo sapiens
NP_680086 6.8e-80 96.9 sorting nexin-1...
Homo sapiens
EAW74337 8.5e-80 96.9 hCG23393, isofo...
Homo sapiens
AAF89956 7.5e-79 96.5 sorting nexin 1...
Homo sapiens
BAG53293 2.4e-78 97.3 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001683 7 125 PF00787 Phox-like
HMMSmart IPR001683 7 125 SM00312 Phox-like
ProfileScan IPR001683 1 129 PS50195 Phox-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp