ORK05893

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05893

Order Kazusa clone(s) from :

Accession No	AK226141
Product ID	ORK05893
Clone name	pj01621
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LSS
cDNA sequence	DNA sequence (4298 bp) Predicted protein sequence (733 aa)
Description	Lanosterol synthase (EC 5.4.99.7) (Oxidosqualene--lanosterol cyclase) (2,3-epoxysqualene--lanosterol cyclase) (OSC).

Features of the cloned cDNA sequence

Description

Length: 4298 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1975 bp
Genome contig ID	gi51511750r_46333471
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATCTGCCTTAATAAACAGACATTGATTCCCTTATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAGCCTGTCACACTGTGTTTCGTTTCATCCTGGGGAGAACTGCAGATT

Features of the protein sequence

Description

Length: 733 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX09300	99.8	lanosterol synt...	Homo sapiens
AAH35638	100.0	Lanosterol synt...	Homo sapiens
P48449	99.8	Lanosterol synt...	Homo sapiens
BAG35391	99.8	unnamed protein...	Homo sapiens
CAB42828	99.7	lanosterol synt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001330	123	166	PF00432	Prenyltransferase/squalene oxidase
	IPR001330	559	601	PF00432	Prenyltransferase/squalene oxidase
	IPR001330	611	659	PF00432	Prenyltransferase/squalene oxidase
HMMTigr	IPR002365	77	722	TIGR01787	Terpene synthase
ScanRegExp	IPR002365	575	589	PS01074	Terpene synthase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp