ORK06051

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06051

Order Kazusa clone(s) from :

Accession No	AK226109
Product ID	ORK06051
Clone name	pj01722
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MTMR1
cDNA sequence	DNA sequence (4337 bp) Predicted protein sequence (713 aa)
Description	Myotubularin-related protein 1 (EC 3.1.3.-).

Features of the cloned cDNA sequence

Description

Length: 4337 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2194 bp
Genome contig ID	gi89161218f_149512541
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTCAATCATCTGTAATTAAAATGATCATATGTTT
Flanking genome sequence (171516 - 171565)	----+--------+--------+--------+--------+----* GCTCCCTGGTCTTTTTTAAGTAAGTAAGTAAGTATCTTAGTAGATTTTTC

Features of the protein sequence

Description

Length: 713 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13613	98.8	Myotubularin-re...	Homo sapiens
CAA12271	98.6	MTMR1 [Homo sap...	Homo sapiens
XP_521304	96.8	myotubularin-re...	Pan troglodytes
XP_614787	92.3	similar to myot...	Bos taurus
Q9Z2C4	91.5	Myotubularin-re...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004182	152	209	PF02893	GRAM
HMMPfam	IPR010569	303	420	PF06602	Myotubularin-related
HMMSmart	IPR004182	141	209	SM00568	GRAM
HMMSmart	IPR003595	434	582	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR000387	455	502	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	484	496	PS00383	Protein-tyrosine phosphatase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp