ORK04817

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04817

Order Kazusa clone(s) from :

Accession No	AB208833
Product ID	ORK04817
Clone name	pj01914
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNMT3A
cDNA sequence	DNA sequence (4476 bp) Predicted protein sequence (811 aa)
Description	DNA (cytosine-5)-methyltransferase 3A (EC 2.1.1.37) (Dnmt3a) (DNA methyltransferase HsaIIIA) (DNA MTase HsaIIIA) (M.HsaIIIA).

Features of the cloned cDNA sequence

Description

Length: 4476 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1893 bp
Genome contig ID	gi89161199r_25209369
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CCCACCTGGAGCAAATAAAAAAACATACAAAACGT
Flanking genome sequence (99981 - 99932)	----+--------+--------+--------+--------+----* ACTGGTGCTTTCCTGTCTAAGTCGCCTTTTGTGTGTTCTTTTATGAGGCC

Features of the protein sequence

Description

Length: 811 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92070	100.0	DNA cytosine me...	Homo sapiens
Q9Y6K1	100.0	DNA (cytosine-5...	Homo sapiens
ABZ92480	99.7	DNA (cytosine-5...	synthetic construct
EAX00728	99.7	DNA (cytosine-5...	Homo sapiens
AAL57039	100.0	DNA cytosine me...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000313	319	392	PF00855	PWWP
HMMPfam	IPR001525	715	774	PF00145	C-5 cytosine-specific DNA methylase
HMMSmart	IPR000313	320	378	SM00293	PWWP
ProfileScan	IPR000313	322	380	PS50812	PWWP
ScanRegExp	IPR001525	732	744	PS00094	C-5 cytosine-specific DNA methylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp