ORK07188

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07188

Order Kazusa clone(s) from :

Accession No	AB208879
Product ID	ORK07188
Clone name	pj02337
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TOP2B
cDNA sequence	DNA sequence (4814 bp) Predicted protein sequence (1009 aa)
Description	DNA topoisomerase 2-beta (EC 5.99.1.3) (DNA topoisomerase II, beta isozyme).

Features of the cloned cDNA sequence

Description

Length: 4814 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	315 bp
Genome contig ID	gi89161205r_25514487
PolyA signal sequence (ATTAAA,-10)	+--------+--------+----*----+---- CTGCTTTTTGAAATGAAATTTAAACATTAAAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAACTGTGTTCTCTGTCTCTTTACTGAAGATAAAGGTGTAGTAAAAGCTC

Features of the protein sequence

Description

Length: 1009 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92116	100.0	DNA topoisomera...	Homo sapiens
EAW64357	99.9	topoisomerase (...	Homo sapiens
Q02880	99.9	DNA topoisomera...	Homo sapiens
CAA78821	99.8	DNA topoisomera...	Homo sapiens
XP_516332	99.8	DNA topoisomera...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002205	140	209	PD000742	DNA topoisomerase
FPrintScan	IPR001154	20	32	PR01158	DNA topoisomerase II
	IPR001154	145	168	PR01158	DNA topoisomerase II
	IPR001154	192	214	PR01158	DNA topoisomerase II
	IPR001154	222	242	PR01158	DNA topoisomerase II
	IPR001154	327	341	PR01158	DNA topoisomerase II
	IPR001154	411	437	PR01158	DNA topoisomerase II
HMMPfam	IPR002205	117	584	PF00521	DNA topoisomerase
HMMPfam	IPR012542	891	994	PF08070	DTHCT
HMMSmart	IPR002205	97	570	SM00434	DNA topoisomerase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp