ORK06110

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06110

Order Kazusa clone(s) from :

Accession No	AB209443
Product ID	ORK06110
Clone name	pj02402
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NCAM1
cDNA sequence	DNA sequence (4696 bp) Predicted protein sequence (807 aa)
Description	Neural cell adhesion molecule 1, 140 kDa isoform precursor (N-CAM 140) (NCAM-140) (CD56 antigen).

Features of the cloned cDNA sequence

Description

Length: 4696 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2270 bp
Genome contig ID	gi51511727f_112237300
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- CCTTTGCATTATTAAAGGAAATAACAGTTCATGTG
Flanking genome sequence (403829 - 403878)	----+--------+--------+--------+--------+----* AACTCACCAGCGTGGCTTGATTTTATTCAATAGTTGTGTCTGACAAAGCA

Features of the protein sequence

Description

Length: 807 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92680	100.0	Neural cell adh...	Homo sapiens
XP_001082361	99.3	neural cell adh...	Macaca mulatta
P13591	97.3	Neural cell adh...	Homo sapiens
XP_001083697	97.1	neural cell adh...	Macaca mulatta
AAB04558	96.9	neural cell adh...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR009138	101	128	PR01838	Neural cell adhesion
	IPR009138	194	221	PR01838	Neural cell adhesion
	IPR009138	272	300	PR01838	Neural cell adhesion
	IPR009138	366	395	PR01838	Neural cell adhesion
HMMPfam	IPR013098	101	195	PF07679	Immunoglobulin I-set
	IPR013151	213	272	PF00047	Immunoglobulin
	IPR013098	295	385	PF07679	Immunoglobulin I-set
	IPR013098	389	483	PF07679	Immunoglobulin I-set
	IPR013151	500	562	PF00047	Immunoglobulin
	IPR003961	581	669	PF00041	Fibronectin
	IPR003961	683	767	PF00041	Fibronectin
HMMSmart	IPR003599	107	196	SM00409	Immunoglobulin subtype
	IPR003598	113	184	SM00408	Immunoglobulin subtype 2
	IPR003599	205	290	SM00409	Immunoglobulin subtype
	IPR003598	211	277	SM00408	Immunoglobulin subtype 2
	IPR003599	301	386	SM00409	Immunoglobulin subtype
	IPR003598	307	375	SM00408	Immunoglobulin subtype 2
	IPR003599	395	484	SM00409	Immunoglobulin subtype
	IPR003598	401	473	SM00408	Immunoglobulin subtype 2
	IPR003599	492	579	SM00409	Immunoglobulin subtype
	IPR003598	498	567	SM00408	Immunoglobulin subtype 2
	IPR003961	581	666	SM00060	Fibronectin
	IPR003961	683	764	SM00060	Fibronectin
ProfileScan	IPR007110	101	192	PS50835	Immunoglobulin-like
	IPR007110	197	270	PS50835	Immunoglobulin-like
	IPR007110	293	382	PS50835	Immunoglobulin-like
	IPR007110	389	484	PS50835	Immunoglobulin-like
	IPR007110	487	572	PS50835	Immunoglobulin-like
	IPR003961	577	676	PS50853	Fibronectin
	IPR003961	679	773	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	5	DLRVASVLRLGLSLILRSAR	24	SECONDARY	20
	2	86	KDLIWTLFFLGTAVSLQVDIVP	107	PRIMARY	22
	3	786	GNSASYTFVSLLFSAVTLLLLC	807	PRIMARY	22