Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10440
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10440
Clone name sh02545
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol WAC
cDNA sequence DNA sequence (5461 bp)
Predicted protein sequence (670 aa)
Description WW domain-containing adapter protein with coiled-coil
Features of the cloned cDNA sequence

Length: 5461 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3405 bp
Genome contig ID gi89161187f_28761790
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATGACACTGAAAAGTAATAAATATGTTTTGACTAT
Flanking genome sequence
(190159 - 190208)
----+----*----+----*----+----*----+----*----+----*
ATTGTGCAGTTATTTCAGAACTGTGTTTTGAAAGTCTTAGAATGCATAAT

Features of the protein sequence

Length: 670 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001106227 4.3e-182 98.7 similar to WW d...
Macaca mulatta
Q9BTA9 4.9e-176 98.9 WW domain-conta...
Homo sapiens
BAD97320 8.9e-176 98.7 WW domain-conta...
Homo sapiens
XP_507721 5.1e-175 99.5 WW domain-conta...
Pan troglodytes
AAH04258 3.8e-174 98.5 WW domain conta...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001202 154 183 PF00397 WW/Rsp5/WWP
HMMSmart IPR001202 153 185 SM00456 WW/Rsp5/WWP
ProfileScan IPR001202 158 185 PS50020 WW/Rsp5/WWP
ScanRegExp IPR001202 158 183 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp