ORK06684

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06684

Order Kazusa clone(s) from :

Accession No	AB209627
Product ID	ORK06684
Clone name	sh02837
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RPL28
cDNA sequence	DNA sequence (5622 bp) Predicted protein sequence (95 aa)
Description	60S ribosomal protein L28.

Features of the cloned cDNA sequence

Description

Length: 5622 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5333 bp
Genome contig ID	gi42406306f_60489528
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CCAGTTACTAGAATAAAATCATCTACTTTAAAATC
Flanking genome sequence (105741 - 105790)	----+--------+--------+--------+--------+----* TTTCATTATGAAATATGCATGTGGTCTTGAAAAACTGCAAATGAAAGAAG

Features of the protein sequence

Description

Length: 95 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92864	3.5e-42	100.0	ribosomal prote...	Homo sapiens
EAW72375	1e-38	100.0	ribosomal prote...	Homo sapiens
XP_520919	4.3e-31	97.4	similar to ribo...	Pan troglodytes
XP_533581	9.9e-30	93.5	similar to ribo...	Canis lupus fam...
BAE89555	4.8e-28	98.5	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002672	10	94	PF01778	Ribosomal L28e protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp