ORK07153

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07153

Order Kazusa clone(s) from :

Accession No	AB209649
Product ID	ORK07153
Clone name	sh06595
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPB41
cDNA sequence	DNA sequence (5770 bp) Predicted protein sequence (827 aa)
HaloTag ORF Clone	FHC07153
Flexi ORF Clone	FXC07153
Description	TTMB protein (Fragment).

Features of the cloned cDNA sequence

Description

Length: 5770 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3227 bp
Genome contig ID	gi89161185f_28986190
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTATTGCATTTTTTTCAATAAACAACAACAAAAAG
Flanking genome sequence (332950 - 332999)	----+--------+--------+--------+--------+----* AACTCTCTCTGTGAGGATTGATCCACTTTTAAATTTCTCTTCTACCAGCA

Features of the protein sequence

Description

Length: 827 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92886	100.0	Protein 4.1 var...	Homo sapiens
Q6Q7P4	93.0	Protein 4.1; Sh...	Canis lupus fam...
AAH68138	89.2	Epb4.1 protein ...	Mus musculus
AAH79875	90.3	Epb4.1 protein ...	Mus musculus
XP_513260	82.4	erythrocyte mem...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	240	259	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	260	272	PR00935	Band 4.1
	IPR000798	290	309	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	324	337	PR00935	Band 4.1
	IPR000798	333	354	PR00661	Ezrin/radixin/moesin ERM
	IPR000299	337	357	PR00935	Band 4.1
	IPR000299	398	414	PR00935	Band 4.1
	IPR000798	421	441	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	229	418	PF00373	Band 4.1
	IPR014847	513	559	PF08736	FERM adjacent (FA)
	IPR007477	614	678	PF04382	SAB
	IPR008379	710	824	PF05902	Band 4.1
HMMSmart	IPR000299	223	418	SM00295	Band 4.1
ProfileScan	IPR000299	227	508	PS50057	Band 4.1
ScanRegExp	IPR000299	281	309	PS00660	Band 4.1
ScanRegExp	IPR000299	388	417	PS00661	Band 4.1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp