ORK04602

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04602

Order Kazusa clone(s) from :

Accession No	AB209571
Product ID	ORK04602
Clone name	sj00324
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	COL16A1
cDNA sequence	DNA sequence (4544 bp) Predicted protein sequence (1463 aa)
Description	Collagen alpha-1(XVI) chain precursor.

Features of the cloned cDNA sequence

Description

Length: 4544 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	150 bp
Genome contig ID	gi89161185r_31790758
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGTTAATATTTTTTAAATAATAAAGAAACAAAACT
Flanking genome sequence (99931 - 99882)	----+--------+--------+--------+--------+----* ATCTGCCCTTTCCCTTCCAGTGGGTTCCTCTGGTGCTGCAGCCAGAGCTC

Features of the protein sequence

Description

Length: 1463 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92808	100.0	alpha 1 type XV...	Homo sapiens
Q8BLX7	86.6	Collagen alpha-...	Mus musculus
BAC30765	86.5	unnamed protein...	Mus musculus
CAQ51589	86.5	procollagen typ...	Mus musculus
Q07092	97.9	Collagen alpha-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008160	265	324	PF01391	Collagen triple helix repeat
	IPR008160	361	399	PF01391	Collagen triple helix repeat
	IPR008160	474	524	PF01391	Collagen triple helix repeat
	IPR008160	560	619	PF01391	Collagen triple helix repeat
	IPR008160	646	676	PF01391	Collagen triple helix repeat
	IPR008160	677	731	PF01391	Collagen triple helix repeat
	IPR008160	732	765	PF01391	Collagen triple helix repeat
	IPR008160	778	810	PF01391	Collagen triple helix repeat
	IPR008160	922	981	PF01391	Collagen triple helix repeat
	IPR008160	982	1041	PF01391	Collagen triple helix repeat
	IPR008160	1054	1106	PF01391	Collagen triple helix repeat
	IPR008160	1108	1167	PF01391	Collagen triple helix repeat
	IPR008160	1173	1232	PF01391	Collagen triple helix repeat
	IPR008160	1233	1292	PF01391	Collagen triple helix repeat
	IPR008160	1331	1385	PF01391	Collagen triple helix repeat
	IPR008160	1405	1436	PF01391	Collagen triple helix repeat
HMMSmart	IPR003129	1	121	SM00210	Laminin G

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp