ORK11856

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11856

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11856
Clone name	sj01179
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RGS3
cDNA sequence	DNA sequence (4158 bp) Predicted protein sequence (546 aa)
Description	Regulator of G-protein signaling 3 (RGS3)(RGP3)

Features of the cloned cDNA sequence

Description

Length: 4158 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	784 bp
Genome contig ID	gi89161216f_115283854
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- AGCAAATAAAAGGCCTGTGTTATTTCTTGTTCTTG
Flanking genome sequence (115986 - 116035)	----+--------+--------+--------+--------+----* ACCCTTTTTGTGTGTTCCTGGTCTTGAGCCTTCCCAGGGTGGCTGGGGCT

Features of the protein sequence

Description

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH70841	1.9e-145	99.8	regulator of G-...	Homo sapiens
AAM33255	1.9e-145	99.8	RGS3 isoform PD...	Homo sapiens
AAL68829	1.9e-145	99.8	PDZ-RGS3 [Homo ...	Homo sapiens
EAW87390	2.2e-145	99.8	regulator of G-...	Homo sapiens
BAG54130	2.2e-145	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	78	165	PD297513	NULL
BlastProDom	IPR000342	441	541	PD001580	Regulator of G protein signalling
FPrintScan	IPR000342	418	439	PR01301	Regulator of G protein signalling
	IPR000342	440	458	PR01301	Regulator of G protein signalling
	IPR000342	469	492	PR01301	Regulator of G protein signalling
	IPR000342	511	530	PR01301	Regulator of G protein signalling
HMMPfam	IPR000342	421	537	PF00615	Regulator of G protein signalling
HMMSmart	IPR000342	421	537	SM00315	Regulator of G protein signalling
ProfileScan	IPR000342	421	537	PS50132	Regulator of G protein signalling

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp