Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11844
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11844
Clone name sj03005
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ITK
cDNA sequence DNA sequence (4481 bp)
Predicted protein sequence (659 aa)
Description Tyrosine-protein kinase ITK/TSK (EC 2.7.10.2)(T-cell-specific kinase)(Tyrosine-protein kinase Lyk)(Kinase EMT)
Features of the cloned cDNA sequence

Length: 4481 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2500 bp
Genome contig ID gi51511721f_156440449
PolyA signal sequence
(AATAAA,-13)		 
+----*----+----*----+----*----+----
AGCAATATTAAAGCTGCATTTTAATAAATATGGTG
Flanking genome sequence
(174319 - 174368)		 
----+----*----+----*----+----*----+----*----+----*
CATAGGGCCTCGGTTCCATATTTATTTAAATCGCAAACTCTCAGAACTTT

Features of the protein sequence

Length: 659 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q08881 0 100.0 Tyrosine-protei...
 Homo sapiens
AAQ02517 0 100.0 IL2-inducible T...
 synthetic construct
AAB28072 0 99.8 EMT [Homo sapiens].
 Homo sapiens
XP_001136073 0 99.6 similar to tyro...
 Pan troglodytes
XP_001113468 0 99.0 similar to IL2-...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001452 213 265 PD000066 Src homology-3
IPR000980 278 378 PD000093 SH2 motif
IPR000719 407 644 PD000001 Protein kinase
FPrintScan IPR001452 213 223 PR00452 Src homology-3
IPR001452 227 242 PR00452 Src homology-3
IPR001452 256 268 PR00452 Src homology-3
IPR000980 278 292 PR00401 SH2 motif
IPR000980 298 308 PR00401 SH2 motif
IPR000980 309 320 PR00401 SH2 motif
IPR000980 328 338 PR00401 SH2 motif
IPR000980 351 365 PR00401 SH2 motif
IPR001245 474 487 PR00109 Tyrosine protein kinase
IPR001245 511 529 PR00109 Tyrosine protein kinase
IPR001245 559 569 PR00109 Tyrosine protein kinase
IPR001245 578 600 PR00109 Tyrosine protein kinase
IPR001245 622 644 PR00109 Tyrosine protein kinase
HMMPfam IPR001849 44 150 PF00169 Pleckstrin-like
IPR001562 152 188 PF00779 Tec/Btk
IPR001452 213 268 PF00018 Src homology-3
IPR000980 278 362 PF00017 SH2 motif
IPR001245 402 651 PF07714 Tyrosine protein kinase
HMMSmart IPR001849 44 152 SM00233 Pleckstrin-like
IPR001562 152 188 SM00107 Tec/Btk
IPR001452 213 269 SM00326 Src homology-3
IPR000980 276 368 SM00252 SH2 motif
IPR001245 402 651 SM00219 Tyrosine protein kinase
IPR002290 402 652 SM00220 Serine/threonine protein kinase
ProfileScan IPR001849 43 150 PS50003 Pleckstrin-like
IPR001562 152 188 PS51113 Tec/Btk
IPR001452 210 270 PS50002 Src homology-3
IPR000980 278 377 PS50001 SH2 motif
IPR000719 402 654 PS50011 Protein kinase
ScanRegExp IPR000719 408 430 PS00107 Protein kinase
IPR008266 517 529 PS00109 Tyrosine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp