ORK05021

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05021

Order Kazusa clone(s) from :

Accession No	AB209584
Product ID	ORK05021
Clone name	sj04505
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FHOD1
cDNA sequence	DNA sequence (4321 bp) Predicted protein sequence (1017 aa)
Description	FH1/FH2 domain-containing protein 1 (Formin homolog overexpressed in spleen 1) (FHOS) (Formin homology 2 domain-containing protein 1).

Features of the cloned cDNA sequence

Description

Length: 4321 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	245 bp
Genome contig ID	gi51511732r_65720795
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CGCACGGAGCAAAATAAAATTTTCTTAGCTAATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAGGTTTCTCTTCTTTCAGGGTCCCCACCAGGCTGGGTTTGTAGCAGG

Features of the protein sequence

Description

Length: 1017 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92821	100.0	P127 variant [H...	Homo sapiens
Q9Y613	99.9	FH1/FH2 domain-...	Homo sapiens
BAD06250	99.8	p127 [Homo sapi...	Homo sapiens
XP_511029	99.3	formin homology...	Pan troglodytes
AAD39906	99.0	FH1/FH2 domain-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015425	470	841	PF02181	Actin-binding FH2
HMMSmart	IPR003104	469	921	SM00498	Actin-binding FH2 and DRF autoregulatory
ProfileScan	IPR014768	1	311	PS51232	GTPase-binding/formin homology 3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp