ORK11627

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11627

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11627
Clone name	sj05255
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BMP1
cDNA sequence	DNA sequence (4333 bp) Predicted protein sequence (803 aa)
HaloTag ORF Clone	FHC11627
Flexi ORF Clone	FXC11627
Description	bone morphogenetic protein 1

Features of the cloned cDNA sequence

Description

Length: 4333 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1921 bp
Genome contig ID	gi51511724f_21978645
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGCACCGCAGCCAATAAACCGAAAGTGTTACAGCC
Flanking genome sequence (147139 - 147188)	----+--------+--------+--------+--------+----* AATATCCTGTGCCAGATGCTGTCTGGGCCATGGGGGCGGGGCCATCATGT

Features of the protein sequence

Description

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92827	100.0	bone morphogene...	Homo sapiens
AAA51833	99.8	bone morphogene...	Homo sapiens
CAA69975	98.6	BMP1-6 [Homo sa...	Homo sapiens
P13497	99.7	Bone morphogene...	Homo sapiens
AAI42954	99.7	Bone morphogene...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001506	224	242	PR00480	Peptidase M12A
	IPR001506	278	296	PR00480	Peptidase M12A
	IPR001506	297	314	PR00480	Peptidase M12A
	IPR001506	336	351	PR00480	Peptidase M12A
	IPR001506	378	391	PR00480	Peptidase M12A
HMMPfam	IPR001506	201	394	PF01400	Peptidase M12A
	IPR000859	395	504	PF00431	CUB
	IPR000859	508	617	PF00431	CUB
	IPR013091	621	660	PF07645	EGF calcium-binding
	IPR000859	664	773	PF00431	CUB
HMMSmart	IPR006026	199	341	SM00235	Peptidase
	IPR000859	395	507	SM00042	CUB
	IPR000859	508	620	SM00042	CUB
	IPR001881	620	661	SM00179	EGF-like calcium-binding
	IPR006210	623	661	SM00181	EGF
	IPR000859	664	776	SM00042	CUB
ProfileScan	IPR000859	395	507	PS01180	CUB
	IPR000859	508	620	PS01180	CUB
	IPR000742	620	661	PS50026	EGF-like
	IPR000859	664	776	PS01180	CUB
ScanRegExp	IPR006025	283	292	PS00142	Peptidase M
	IPR001881	620	645	PS01187	EGF-like calcium-binding
	IPR000152	636	647	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	645	660	PS01186	EGF-like region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp