ORK00069

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00069

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00069
Clone name	hg02120s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SRGAP3
cDNA sequence	DNA sequence (6929 bp) Predicted protein sequence (1109 aa)
HaloTag ORF Clone	FHC00069
Flexi ORF Clone	FXC00069
Description	SLIT-ROBO Rho GTPase activating protein 3

Features of the cloned cDNA sequence

Description

Length: 6929 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3027 bp
Genome contig ID	gi89161205r_8899176
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTAAAAAGGCTACAATTAAATTTTAGCCAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCACCAAATCTTTGCACCTAGTAGATAGATCAATGTAAAAACAAATAC

Features of the protein sequence

Description

Length: 1109 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAN57784	100.0	WAVE-associated...	Homo sapiens
XP_590495	99.5	similar to SLIT...	Bos taurus
XP_001495819	99.4	SLIT-ROBO Rho G...	Equus caballus
XP_001097317	98.9	similar to SLIT...	Macaca mulatta
EAW63950	100.0	SLIT-ROBO Rho G...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	759	808	PD000066	Src homology-3
FPrintScan	IPR001452	771	786	PR00452	Src homology-3
	IPR001452	788	797	PR00452	Src homology-3
	IPR001452	799	811	PR00452	Src homology-3
HMMPfam	IPR001060	56	154	PF00611	Cdc15/Fes/CIP4
	IPR000198	530	683	PF00620	RhoGAP
	IPR001452	757	811	PF00018	Src homology-3
HMMSmart	IPR001060	56	154	SM00055	Cdc15/Fes/CIP4
	IPR000198	527	701	SM00324	RhoGAP
	IPR001452	757	812	SM00326	Src homology-3
ProfileScan	IPR001060	56	121	PS50133	Cdc15/Fes/CIP4
	IPR000198	516	704	PS50238	RhoGAP
	IPR001452	754	813	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp