ORK00092

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00092

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00092
Clone name	hg01394s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	WSCD1
cDNA sequence	DNA sequence (5818 bp) Predicted protein sequence (619 aa)
HaloTag ORF Clone	FHC00092
Flexi ORF Clone	FXC00092
Description	WSC domain containing 1

Features of the cloned cDNA sequence

Description

Length: 5818 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3765 bp
Genome contig ID	gi51511734f_5824413
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGTTATATGAGCTAATAAATTCTGTTTATTGTTT
Flanking genome sequence (144058 - 144107)	----+--------+--------+--------+--------+----* AAGTTGGGTTGAGTTTAATTTCTGTTACTTATAACTCAGAACATGGTGCA

Features of the protein sequence

Description

Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH09975	99.8	WSCD1 protein [...	Homo sapiens
XP_001101952	98.2	similar to CG91...	Macaca mulatta
EDL12651	84.6	cDNA sequence B...	Mus musculus
XP_848808	89.2	similar to CG91...	Canis lupus fam...
XP_001918396	85.8	WSC domain cont...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002889	189	268	PF01822	Carbohydrate-binding WSC
HMMPfam	IPR002889	292	374	PF01822	Carbohydrate-binding WSC
HMMSmart	IPR013994	186	278	SM00321	Carbohydrate-binding WSC
HMMSmart	IPR013994	289	384	SM00321	Carbohydrate-binding WSC
ProfileScan	IPR002889	186	278	PS51212	Carbohydrate-binding WSC
ProfileScan	IPR002889	289	384	PS51212	Carbohydrate-binding WSC

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp