ORK00300

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK00300

Order Kazusa clone(s) from :

Accession No
Product ID	ORK00300
Clone name	fj13109
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZFP82
cDNA sequence	DNA sequence (4198 bp) Predicted protein sequence (545 aa)
HaloTag ORF Clone	FHC00300
Flexi ORF Clone	FXC00300
Description	Zinc finger protein 545.

Features of the cloned cDNA sequence

Description

Length: 4198 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2386 bp
Genome contig ID	gi42406306r_41473233
PolyA signal sequence (AATACA,-10)	+--------+--------+----*----+---- GAAGTAATGGCCTAGTTTTTTAACCAATACATGTC
Flanking genome sequence (99859 - 99810)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGACAAAAATGGAATCCTACACTTTAAAGGAGA

Features of the protein sequence

Description

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N141	0	100.0	Zinc finger pro...	Homo sapiens
BAC11308	0	99.6	unnamed protein...	Homo sapiens
XP_001112876	0	97.2	similar to zinc...	Macaca mulatta
XP_001788291	2.5e-206	91.4	similar to zinc...	Bos taurus
XP_001494637	6e-205	93.2	similar to zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	183	206	PD000003	Zinc finger
	IPR007087	211	234	PD000003	Zinc finger
	IPR007087	239	261	PD000003	Zinc finger
	IPR007087	267	290	PD000003	Zinc finger
	IPR007087	295	315	PD000003	Zinc finger
	IPR007087	323	346	PD000003	Zinc finger
	IPR007087	351	374	PD000003	Zinc finger
	IPR007087	379	402	PD000003	Zinc finger
	IPR007087	407	429	PD000003	Zinc finger
	IPR007087	435	457	PD000003	Zinc finger
	IPR007087	463	486	PD000003	Zinc finger
	IPR007087	491	514	PD000003	Zinc finger
	IPR007087	519	541	PD000003	Zinc finger
HMMPfam	IPR001909	19	59	PF01352	KRAB box
	IPR007087	183	205	PF00096	Zinc finger
	IPR007087	211	233	PF00096	Zinc finger
	IPR007087	239	261	PF00096	Zinc finger
	IPR007087	267	289	PF00096	Zinc finger
	IPR007087	295	317	PF00096	Zinc finger
	IPR007087	351	373	PF00096	Zinc finger
	IPR007087	379	401	PF00096	Zinc finger
	IPR007087	407	429	PF00096	Zinc finger
	IPR007087	435	457	PF00096	Zinc finger
	IPR007087	463	485	PF00096	Zinc finger
	IPR007087	491	513	PF00096	Zinc finger
	IPR007087	519	541	PF00096	Zinc finger
HMMSmart	IPR001909	19	79	SM00349	KRAB box
	IPR015880	183	205	SM00355	Zinc finger
	IPR015880	211	233	SM00355	Zinc finger
	IPR015880	239	261	SM00355	Zinc finger
	IPR015880	267	289	SM00355	Zinc finger
	IPR015880	295	315	SM00355	Zinc finger
	IPR015880	323	345	SM00355	Zinc finger
	IPR015880	351	373	SM00355	Zinc finger
	IPR015880	379	401	SM00355	Zinc finger
	IPR015880	407	429	SM00355	Zinc finger
	IPR015880	435	457	SM00355	Zinc finger
	IPR015880	463	485	SM00355	Zinc finger
	IPR015880	491	513	SM00355	Zinc finger
	IPR015880	519	541	SM00355	Zinc finger
ProfileScan	IPR001909	19	90	PS50805	KRAB box
	IPR007087	183	210	PS50157	Zinc finger
	IPR007087	211	238	PS50157	Zinc finger
	IPR007087	239	266	PS50157	Zinc finger
	IPR007087	267	294	PS50157	Zinc finger
	IPR007087	295	322	PS50157	Zinc finger
	IPR007087	323	350	PS50157	Zinc finger
	IPR007087	351	378	PS50157	Zinc finger
	IPR007087	379	406	PS50157	Zinc finger
	IPR007087	407	434	PS50157	Zinc finger
	IPR007087	435	462	PS50157	Zinc finger
	IPR007087	463	490	PS50157	Zinc finger
	IPR007087	491	518	PS50157	Zinc finger
	IPR007087	519	545	PS50157	Zinc finger
ScanRegExp	IPR007087	185	205	PS00028	Zinc finger
	IPR007087	213	233	PS00028	Zinc finger
	IPR007087	241	261	PS00028	Zinc finger
	IPR007087	269	289	PS00028	Zinc finger
	IPR007087	325	345	PS00028	Zinc finger
	IPR007087	353	373	PS00028	Zinc finger
	IPR007087	381	401	PS00028	Zinc finger
	IPR007087	409	429	PS00028	Zinc finger
	IPR007087	437	457	PS00028	Zinc finger
	IPR007087	465	485	PS00028	Zinc finger
	IPR007087	493	513	PS00028	Zinc finger
	IPR007087	521	541	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp