ORK01006

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01006

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01006
Clone name	hk09982
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RAD17
cDNA sequence	DNA sequence (4019 bp) Predicted protein sequence (680 aa)
HaloTag ORF Clone	FHC01006
Flexi ORF Clone	FXC01006
Description	Cell cycle checkpoint protein RAD17 (hRad17) (RF-C/activator 1 homolog).

Features of the cloned cDNA sequence

Description

Length: 4019 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	507 bp
Genome contig ID	gi51511721f_68601431
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TACATAAGTTATATCACAATTAAAATGTTGAATTT
Flanking genome sequence (144953 - 145002)	----+--------+--------+--------+--------+----* AATTTTGTTTCTCCTGTCTTTTAACATTATCTAGCACGCACTCGCTGCCA

Features of the protein sequence

Description

Length: 680 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAA06251	100.0	cell cycle chec...	Homo sapiens
AAX37147	100.0	RAD17-like [syn...	synthetic construct
CAD97683	99.8	hypothetical pr...	Homo sapiens
AAD01620	99.8	cell cycle chec...	Homo sapiens
AAD38878	99.8	hRad17 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004582	82	592	PF03215	Checkpoint protein Rad24
HMMTigr	IPR004582	12	651	TIGR00602	Checkpoint protein Rad24

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp