ORK01013

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01013

Order Kazusa clone(s) from :

Accession No	AB210030
Product ID	ORK01013
Clone name	hh05253
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh05253 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCGC CCACGCGTCC G) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	SEMA4D
cDNA sequence	DNA sequence (5682 bp) Predicted protein sequence (870 aa)
HaloTag ORF Clone	FHC01013
Flexi ORF Clone	FXC01013
Description	Semaphorin-4D precursor (Leukocyte activation antigen CD100) (BB18) (A8) (GR3).

Features of the cloned cDNA sequence

Description

Length: 5682 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2316 bp
Genome contig ID	gi89161216r_91081357
PolyA signal sequence (None)	+--------+--------+----*----+---- TCCCAACCTGTGGTATATAGGATTGCTTCTCCCTT
Flanking genome sequence (99764 - 99715)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATTTCAAGAGACAGGGTCTCCCTCTGTCACCAAGGCT

Features of the protein sequence

Description

Length: 870 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE06112	100.0	SEMA4D variant ...	Homo sapiens
XP_001141771	99.4	semaphorin 4D [...	Pan troglodytes
BAG10251	100.0	semaphorin-4D p...	synthetic construct
Q92854	99.8	Semaphorin-4D; ...	Homo sapiens
AAH54500	99.7	Sema domain, im...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001627	58	490	PF01403	Semaphorin/CD100 antigen
	IPR002165	510	562	PF01437	Plexin
	IPR013151	577	634	PF00047	Immunoglobulin
HMMSmart	IPR001627	58	490	SM00630	Semaphorin/CD100 antigen
	IPR003659	510	562	SM00423	Plexin/semaphorin/integrin
	IPR003599	569	655	SM00409	Immunoglobulin subtype
	IPR003598	575	639	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR001627	27	508	PS51004	Semaphorin/CD100 antigen
ProfileScan	IPR007110	562	644	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	RGLLMALAVMFGTAMAFAPIPRI	38	PRIMARY	23
SOSUI2	2	742	RLLMSLFLFFFVLFLCLFFYNCY	764	PRIMARY	23