Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01025
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209839
Product ID ORK01025
Clone name bm05861
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol APBB3
cDNA sequence DNA sequence (1864 bp)
Predicted protein sequence (515 aa)
Flexi ORF Clone FXC01025
Description Amyloid beta A4 precursor protein-binding family B member 3 (Fe65-like protein 2) (Fe65L2).
Features of the cloned cDNA sequence

Length: 1864 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 316 bp
Genome contig ID gi51511721r_139818038
PolyA signal sequence
(AATAAA,-23)		 
+----*----+----*----+----*----+----
AAAATCAGTGCAAATAAAAATCCCTCAGTGACCTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACTGGATGTGAGTATATTGGGCCTGGGACAGGGCTGGGGGCTAACACCCT

Features of the protein sequence

Length: 515 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93076 0 100.0 amyloid beta pr...
 Homo sapiens
XP_001139279 0 98.8 amyloid beta pr...
 Pan troglodytes
XP_001139203 0 97.5 amyloid beta pr...
 Pan troglodytes
XP_517974 0 98.4 amyloid beta pr...
 Pan troglodytes
XP_001139115 0 97.6 amyloid beta pr...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001202 60 88 PF00397 WW/Rsp5/WWP
IPR006020 148 286 PF00640 Phosphotyrosine interaction region
IPR006020 320 446 PF00640 Phosphotyrosine interaction region
HMMSmart IPR001202 59 90 SM00456 WW/Rsp5/WWP
IPR006020 143 289 SM00462 Phosphotyrosine interaction region
IPR006020 315 449 SM00462 Phosphotyrosine interaction region
ProfileScan IPR001202 58 90 PS50020 WW/Rsp5/WWP
IPR006020 148 285 PS01179 Phosphotyrosine interaction region
IPR006020 319 444 PS01179 Phosphotyrosine interaction region
ScanRegExp IPR001202 64 88 PS01159 WW/Rsp5/WWP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp