ORK01199

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01199

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01199
Clone name	ha04660
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of th ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	NCOA2
cDNA sequence	DNA sequence (5695 bp) Predicted protein sequence (1468 aa)
HaloTag ORF Clone	FHC01199
Flexi ORF Clone	FXC01199
Description	Nuclear receptor coactivator 2 (NCoA-2) (Transcriptional intermediary factor 2).

Features of the cloned cDNA sequence

Description

Length: 5695 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	977 bp
Genome contig ID	gi51511724r_71087444
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCACTTACCAATTGCTAAGTATTGAATTTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAATGCATTTACTGGCAAGGAGAAGAGCAAAGTTAAGGCTTGA

Features of the protein sequence

Description

Length: 1468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10541	100.0	nuclear recepto...	synthetic construct
Q15596	99.9	Nuclear recepto...	Homo sapiens
AAI14384	99.8	Nuclear recepto...	Homo sapiens
XP_001082161	99.0	nuclear recepto...	Macaca mulatta
XP_544118	97.1	similar to Nucl...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013767	118	180	PF00989	PAS fold
	IPR014935	640	713	PF08832	Steroid receptor coactivator
	IPR014920	1075	1121	PF08815	Nuclear receptor coactivator
	IPR010011	1285	1342	PF07469	Protein of unknown function DUF1518
HMMSmart	IPR001092	36	93	SM00353	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR000014	118	185	SM00091	PAS
ProfileScan	IPR001092	20	88	PS50888	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR000014	123	187	PS50112	PAS
ScanRegExp	IPR002048	754	766	PS00018	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp