ORK01278

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01278

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01278
Clone name	fk13225
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	APP
cDNA sequence	DNA sequence (3550 bp) Predicted protein sequence (809 aa)
HaloTag ORF Clone	FHC01278
Flexi ORF Clone	FXC01278
Description	amyloid beta (A4) precursor protein

Features of the cloned cDNA sequence

Description

Length: 3550 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1119 bp
Genome contig ID	gi51511750r_26074733
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTTTTCATGTAAATAAATACATTCTTGGAGGAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCATTGTGCTGGTGTGAATGATTCCATAGTAACAATCTTGACCATTTAC

Features of the protein sequence

Description

Length: 809 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P05067	100.0	Amyloid beta A4...	Homo sapiens
Q5IS80	99.8	Amyloid beta A4...	Pan troglodytes
P53601	99.4	Amyloid beta A4...	Macaca fascicularis
P79307	97.7	Amyloid beta A4...	Sus scrofa
Q60495	96.8	Amyloid beta A4...	Cavia porcellus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002223	330	380	PD000222	Proteinase inhibitor I2
FPrintScan	IPR008155	216	234	PR00203	Amyloidogenic glycoprotein
	IPR002223	327	341	PR00759	Proteinase inhibitor I2
	IPR002223	355	365	PR00759	Proteinase inhibitor I2
	IPR002223	365	380	PR00759	Proteinase inhibitor I2
	IPR008155	421	444	PR00203	Amyloidogenic glycoprotein
	IPR013803	714	727	PR00204	Amyloidogenic glycoprotein
	IPR013803	728	740	PR00204	Amyloidogenic glycoprotein
	IPR008155	738	763	PR00203	Amyloidogenic glycoprotein
	IPR013803	740	752	PR00204	Amyloidogenic glycoprotein
	IPR008155	784	806	PR00203	Amyloidogenic glycoprotein
HMMPfam	IPR008154	63	227	PF02177	Amyloidogenic glycoprotein
	IPR002223	329	381	PF00014	Proteinase inhibitor I2
	IPR013803	714	752	PF03494	Amyloidogenic glycoprotein
HMMSmart	IPR008154	63	227	SM00006	Amyloidogenic glycoprotein
HMMSmart	IPR002223	328	381	SM00131	Proteinase inhibitor I2
ProfileScan	IPR002223	330	380	PS50279	Proteinase inhibitor I2
ScanRegExp	IPR008155	220	227	PS00319	Amyloidogenic glycoprotein
	IPR002223	358	376	PS00280	Proteinase inhibitor I2
	IPR008155	795	802	PS00320	Amyloidogenic glycoprotein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	38	VAMLPGLALLLLAAWTARALEVP	60	PRIMARY	23
SOSUI2	2	733	DVGSNKGAIIGLMVGGVVIATVI	755	PRIMARY	23