ORK01279

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01279

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01279
Clone name	sj03418
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITGAD
cDNA sequence	DNA sequence (3912 bp) Predicted protein sequence (1177 aa)
HaloTag ORF Clone	FHC01279
Flexi ORF Clone	FXC01279
Description	integrin, alpha D

Features of the cloned cDNA sequence

Description

Length: 3912 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	377 bp
Genome contig ID	gi51511732f_31212134
PolyA signal sequence (None)	+--------+--------+----*----+---- CTATTTGTGGGCATTGAAAAAGTTTTTTCACTTTC
Flanking genome sequence (133195 - 133244)	----+--------+--------+--------+--------+----* TATGGTGATGGGAGCCTGAGGTCATCTTTTCTTGATGGGGCTGAGAGGTG

Features of the protein sequence

Description

Length: 1177 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92182	100.0	integrin, alpha...	Homo sapiens
AAI56096	100.0	Integrin, alpha...	synthetic construct
Q13349	99.9	Integrin alpha-...	Homo sapiens
XP_001915421	80.3	similar to inte...	Equus caballus
NP_001104272	80.2	integrin, alpha...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	165	182	PR00453	von Willebrand factor
	IPR002035	202	216	PR00453	von Willebrand factor
	IPR002035	268	276	PR00453	von Willebrand factor
	IPR000413	417	429	PR01185	Integrins alpha chain
	IPR000413	434	445	PR01185	Integrins alpha chain
	IPR000413	466	486	PR01185	Integrins alpha chain
	IPR000413	535	559	PR01185	Integrins alpha chain
	IPR000413	599	620	PR01185	Integrins alpha chain
	IPR000413	624	643	PR01185	Integrins alpha chain
	IPR000413	738	751	PR01185	Integrins alpha chain
	IPR000413	1127	1146	PR01185	Integrins alpha chain
HMMPfam	IPR002035	166	344	PF00092	von Willebrand factor
	IPR013517	473	510	PF01839	FG-GAP
	IPR013517	537	571	PF01839	FG-GAP
	IPR013517	599	628	PF01839	FG-GAP
	IPR013649	630	1043	PF08441	Integrin alpha-2
	IPR013513	1140	1154	PF00357	Integrin alpha chain
HMMSmart	IPR013519	47	97	SM00191	Integrin alpha beta-propellor
	IPR002035	164	349	SM00327	von Willebrand factor
	IPR013519	416	465	SM00191	Integrin alpha beta-propellor
	IPR013519	469	526	SM00191	Integrin alpha beta-propellor
	IPR013519	532	588	SM00191	Integrin alpha beta-propellor
	IPR013519	595	646	SM00191	Integrin alpha beta-propellor
ProfileScan	IPR002035	166	348	PS50234	von Willebrand factor
ScanRegExp	IPR013513	1139	1146	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	SGMTFGTVLLLSVLASYHGFN	35	PRIMARY	21
SOSUI2	2	1117	IPIIMGSSVGALLLLALITATLY	1139	PRIMARY	23