ORK01300

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01300

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01300
Clone name	ha06190
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	RET
cDNA sequence	DNA sequence (4062 bp) Predicted protein sequence (1085 aa)
HaloTag ORF Clone	FHC01300
Flexi ORF Clone	FXC01300
Description	ret proto-oncogene

Features of the cloned cDNA sequence

Description

Length: 4062 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	750 bp
Genome contig ID	gi89161187f_42792620
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TCCTTCTTTTGTCTTTGATTAAATACTAGAAATTT
Flanking genome sequence (150340 - 150389)	----+--------+--------+--------+--------+----* TTTCTGTTTCCTAACTTCATCATTGATTGTTTGAAATCTTGGAGTTTCAA

Features of the protein sequence

Description

Length: 1085 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10673	100.0	proto-oncogene ...	synthetic construct
BAF84496	99.9	unnamed protein...	Homo sapiens
AAH04257	99.8	Ret proto-oncog...	Homo sapiens
AAQ02473	99.8	ret proto-oncog...	synthetic construct
P07949	100.0	Proto-oncogene ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	739	1022	PD000001	Protein kinase
FPrintScan	IPR001245	817	830	PR00109	Tyrosine protein kinase
	IPR001245	877	895	PR00109	Tyrosine protein kinase
	IPR001245	926	936	PR00109	Tyrosine protein kinase
	IPR001245	945	967	PR00109	Tyrosine protein kinase
	IPR001245	989	1011	PR00109	Tyrosine protein kinase
HMMPfam	IPR002126	185	274	PF00028	Cadherin
HMMPfam	IPR001245	737	1018	PF07714	Tyrosine protein kinase
HMMSmart	IPR001245	737	1018	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	737	1022	SM00220	Serine/threonine protein kinase
ProfileScan	IPR002126	181	285	PS50268	Cadherin
ProfileScan	IPR000719	737	1029	PS50011	Protein kinase
ScanRegExp	IPR000719	743	771	PS00107	Protein kinase
ScanRegExp	IPR008266	883	895	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	GLRLLLLLLLPLLGKVALGLYF	44	PRIMARY	22
SOSUI2	2	650	VIAAAVLFSFIVSVLLSAFCIHC	672	PRIMARY	23