ORK01302

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01302

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01302
Clone name	hk10145
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk10145 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	TARDBP
cDNA sequence	DNA sequence (4171 bp) Predicted protein sequence (415 aa)
HaloTag ORF Clone	FHC01302
Flexi ORF Clone	FXC01302
Description	TAR DNA-binding protein 43 (TDP-43).

Features of the cloned cDNA sequence

Description

Length: 4171 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2840 bp
Genome contig ID	gi89161185f_10895314
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TGAACCAGATAAATAAAATTTTTTTTTGACACCAC
Flanking genome sequence (112823 - 112872)	----+--------+--------+--------+--------+----* AGTTTAGTGTCTGGAGTCTTACTGGAAAAACACGATTTCTTTTTATATGT

Features of the protein sequence

Description

Length: 415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q13148	4.4e-149	100.0	TAR DNA-binding...	Homo sapiens
ABO32290	4.4e-149	100.0	TDP43 [Homo sap...	Homo sapiens
Q5R5W2	9.4e-149	99.7	TAR DNA-binding...	Pongo abelii
CAL37794	1.1e-148	99.7	hypothetical pr...	synthetic construct
BAD96474	1.4e-148	99.7	TAR DNA binding...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	107	176	PF00076	RNA recognition motif
HMMPfam	IPR000504	194	237	PF00076	RNA recognition motif
HMMSmart	IPR000504	106	177	SM00360	RNA recognition motif
HMMSmart	IPR000504	193	259	SM00360	RNA recognition motif
ProfileScan	IPR000504	105	201	PS50102	RNA recognition motif
ProfileScan	IPR000504	192	263	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp