ORK01322

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01322

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01322
Clone name	hj05636
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	OGG1
cDNA sequence	DNA sequence (4713 bp) Predicted protein sequence (364 aa)
HaloTag ORF Clone	FHC01322
Flexi ORF Clone	FXC01322
Description	N-glycosylase/DNA lyase [Includes: 8-oxoguanine DNA glycosylase (EC 3.2.2.-); DNA-(apurinic or apyrimidinic site) lyase (EC 4.2.99.18) (AP lyase)].

Features of the cloned cDNA sequence

Description

Length: 4713 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3411 bp
Genome contig ID	gi89161205f_9666644
PolyA signal sequence (AAGAAA,-7)	+--------+--------+----*----+---- GGCAACAGAGCGAGACTGCGTCTCAAAAAAGAAAG
Flanking genome sequence (110295 - 110344)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGTTGTTCTTGACTAATCTCAGTGCATTCACACTGAT

Features of the protein sequence

Description

Length: 364 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAD41681	2.6e-142	100.0	8-hydroxyguanin...	Homo sapiens
AAD41682	2e-138	97.2	8-hydroxyguanin...	Homo sapiens
AAH00657	2.7e-138	100.0	8-oxoguanine DN...	Homo sapiens
O15527	2.7e-138	100.0	N-glycosylase/D...	Homo sapiens
EAW63987	5.2e-138	99.6	8-oxoguanine DN...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012904	65	181	PF07934	8-oxoguanine DNA glycosylase
	IPR003265	182	342	PF00730	HhH-GPD
	IPR000445	268	297	PF00633	Helix-hairpin-helix motif
HMMSmart	IPR003265	186	356	SM00478	HhH-GPD
HMMTigr	IPR004577	41	364	TIGR00588	8-oxoguanine DNA-glycosylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp