ORK01326

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01326

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01326
Clone name	hj07570
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIK3R3
cDNA sequence	DNA sequence (5019 bp) Predicted protein sequence (488 aa)
HaloTag ORF Clone	FHC01326
Flexi ORF Clone	FXC01326
Description	Phosphatidylinositol 3-kinase regulatory subunit gamma (PI3-kinase p85-subunit gamma) (PtdIns-3-kinase p85-gamma) (p55PIK).

Features of the cloned cDNA sequence

Description

Length: 5019 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3531 bp
Genome contig ID	gi89161185r_46178401
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GCTCCAGTAATGCAATAAAGACATTGCAATAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTTTGTCTTCATGCTATGAAGGGGTGGGCTGGGGGCAGAGTGGGGG

Features of the protein sequence

Description

Length: 488 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06943	1.2e-167	99.7	phosphoinositid...	Homo sapiens
Q92569	2.9e-167	100.0	Phosphatidylino...	Homo sapiens
ACE86933	3.9e-167	99.3	phosphoinositid...	synthetic construct
CAD97630	4e-167	99.3	hypothetical pr...	Homo sapiens
CAI21702	6.3e-167	99.7	phosphoinositid...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	92	187	PD000093	SH2 motif
BlastProDom	IPR000980	385	480	PD000093	SH2 motif
FPrintScan	IPR001720	86	104	PR00678	PI3 kinase
	IPR000980	92	106	PR00401	SH2 motif
	IPR000980	111	121	PR00401	SH2 motif
	IPR001720	143	157	PR00678	PI3 kinase
	IPR001720	182	205	PR00678	PI3 kinase
	IPR001720	245	263	PR00678	PI3 kinase
	IPR001720	264	286	PR00678	PI3 kinase
	IPR001720	316	335	PR00678	PI3 kinase
	IPR001720	336	361	PR00678	PI3 kinase
	IPR001720	391	413	PR00678	PI3 kinase
	IPR000980	415	426	PR00401	SH2 motif
	IPR001720	416	433	PR00678	PI3 kinase
	IPR000980	427	437	PR00401	SH2 motif
	IPR001720	436	461	PR00678	PI3 kinase
	IPR000980	448	462	PR00401	SH2 motif
HMMPfam	IPR000980	92	167	PF00017	SH2 motif
HMMPfam	IPR000980	385	459	PF00017	SH2 motif
HMMSmart	IPR000980	90	173	SM00252	SH2 motif
HMMSmart	IPR000980	383	465	SM00252	SH2 motif
ProfileScan	IPR000980	92	187	PS50001	SH2 motif
ProfileScan	IPR000980	385	479	PS50001	SH2 motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp