ORK01379

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01379

Order Kazusa clone(s) from :

Accession No	AB209329
Product ID	ORK01379
Clone name	fh11147
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CHL1
cDNA sequence	DNA sequence (5234 bp) Predicted protein sequence (1210 aa)
HaloTag ORF Clone	FHC01379
Flexi ORF Clone	FXC01379
Description	Neural cell adhesion molecule L1-like protein precursor (Close homolog of L1).

Features of the cloned cDNA sequence

Description

Length: 5234 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1140 bp
Genome contig ID	gi89161205f_113454
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CAACAGTTTCAAAATAAAATATCATACAAATATTG
Flanking genome sequence (310083 - 310132)	----+--------+--------+--------+--------+----* AGGGAAATGTTTTCATATTTTTCAAAATAGGTTTTTATTGTTGAATGTAC

Features of the protein sequence

Description

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92566	100.0	Neural cell adh...	Homo sapiens
O00533	100.0	Neural cell adh...	Homo sapiens
XP_001136570	99.0	cell adhesion m...	Pan troglodytes
XP_001497302	91.3	similar to Neur...	Equus caballus
BAG54387	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013098	37	129	PF07679	Immunoglobulin I-set
	IPR013098	243	329	PF07679	Immunoglobulin I-set
	IPR013151	347	405	PF00047	Immunoglobulin
	IPR013098	425	513	PF07679	Immunoglobulin I-set
	IPR013106	576	611	PF07686	Immunoglobulin V-set
	IPR003961	614	700	PF00041	Fibronectin
	IPR003961	713	799	PF00041	Fibronectin
	IPR003961	811	906	PF00041	Fibronectin
	IPR003961	918	1007	PF00041	Fibronectin
HMMSmart	IPR003599	43	130	SM00409	Immunoglobulin subtype
	IPR003598	50	118	SM00408	Immunoglobulin subtype 2
	IPR003599	140	227	SM00409	Immunoglobulin subtype
	IPR003599	249	330	SM00409	Immunoglobulin subtype
	IPR003598	255	319	SM00408	Immunoglobulin subtype 2
	IPR003599	339	421	SM00409	Immunoglobulin subtype
	IPR003598	345	410	SM00408	Immunoglobulin subtype 2
	IPR003599	432	514	SM00409	Immunoglobulin subtype
	IPR003598	438	503	SM00408	Immunoglobulin subtype 2
	IPR003599	523	611	SM00409	Immunoglobulin subtype
	IPR003598	541	600	SM00408	Immunoglobulin subtype 2
	IPR003961	614	697	SM00060	Fibronectin
	IPR003961	714	796	SM00060	Fibronectin
	IPR003961	812	903	SM00060	Fibronectin
	IPR003961	918	1004	SM00060	Fibronectin
ProfileScan	IPR007110	37	126	PS50835	Immunoglobulin-like
	IPR007110	130	225	PS50835	Immunoglobulin-like
	IPR007110	237	330	PS50835	Immunoglobulin-like
	IPR007110	333	419	PS50835	Immunoglobulin-like
	IPR007110	425	512	PS50835	Immunoglobulin-like
	IPR007110	517	609	PS50835	Immunoglobulin-like
	IPR003961	614	706	PS50853	Fibronectin
	IPR003961	713	806	PS50853	Fibronectin
	IPR003961	811	913	PS50853	Fibronectin
	IPR003961	918	1013	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	3	MEPLLLGRGLIVYLMFLLLKFSK	25	PRIMARY	23
SOSUI2	2	1082	QGWFIGLMCAIALLTLLLLTVCF	1104	PRIMARY	23