Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01418
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01418
Clone name fk11601
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol BAG6
cDNA sequence DNA sequence (3659 bp)
Predicted protein sequence (1187 aa)
Flexi ORF Clone FXC01418
Description HLA-B associated transcript 3
Features of the cloned cDNA sequence

Length: 3659 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 93 bp
Genome contig ID gi89161210r_31614798
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACAGTATTTAAGAAATAAAAGTCGGATTTTTCTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTGCTTTCTCTCTACATTGTCTCCATTAGGTAGTGTGTCCCTTAATCTTG

Features of the protein sequence

Length: 1187 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAD18085 0 95.7 BAT3 [Homo sapi...
Homo sapiens
EAX03459 0 95.6 HLA-B associate...
Homo sapiens
AAH03133 0 100.0 HLA-B associate...
Homo sapiens
CAI46045 0 99.9 hypothetical pr...
Homo sapiens
BAB63390 0 99.9 BAT3 [Homo sapi...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000626 83 150 PF00240 Ubiquitin
HMMSmart IPR000626 78 148 SM00213 Ubiquitin
ProfileScan IPR000626 78 138 PS50053 Ubiquitin
ScanRegExp IPR000626 104 129 PS00299 Ubiquitin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp