ORK01423

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01423

Order Kazusa clone(s) from :

Accession No	AB209558
Product ID	ORK01423
Clone name	fk13476
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SRSF1
cDNA sequence	DNA sequence (2953 bp) Predicted protein sequence (233 aa)
HaloTag ORF Clone	FHC01423
Flexi ORF Clone	FXC01423
Description	Splicing factor, arginine/serine-rich 1 (pre-mRNA-splicing factor SF2, P33 subunit) (Alternative-splicing factor 1) (ASF-1).

Features of the cloned cDNA sequence

Description

Length: 2953 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2251 bp
Genome contig ID	gi51511734r_53335854
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTCTTTGAAAAAATAAACATTTTTTAAAAAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGCATGGTTGTCCTTTTTCCTCTTCATGTAAGATTCTAACTGGGTCTAT

Features of the protein sequence

Description

Length: 233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92795	1.7e-85	100.0	splicing factor...	Homo sapiens
XP_523806	3.3e-78	97.3	similar to spli...	Pan troglodytes
XP_001103473	1.2e-77	96.8	similar to spli...	Macaca mulatta
AAH33785	8e-74	100.0	SFRS1 protein [...	Homo sapiens
BAC37367	6.1e-72	98.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	50	118	PF00076	RNA recognition motif
HMMPfam	IPR000504	155	219	PF00076	RNA recognition motif
HMMSmart	IPR000504	49	119	SM00360	RNA recognition motif
HMMSmart	IPR000504	154	220	SM00360	RNA recognition motif
ProfileScan	IPR000504	48	123	PS50102	RNA recognition motif
ProfileScan	IPR000504	153	222	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp