ORK01486

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01486

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01486
Clone name	bm00752
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	IRF3
cDNA sequence	DNA sequence (1631 bp) Predicted protein sequence (465 aa)
HaloTag ORF Clone	FHC01486
Flexi ORF Clone	FXC01486
Description	Interferon regulatory factor 3 (IRF-3).

Features of the cloned cDNA sequence

Description

Length: 1631 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	78 bp
Genome contig ID	gi42406306r_54754639
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CCACCTCAACCAATAAACTGGTTCCTGCTATGATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGTGCGTGTCTGGTGTTGGGTGCCCTCTGACCCAATATGGTTGTTAT

Features of the protein sequence

Description

Length: 465 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14653	6.4e-170	100.0	Interferon regu...	Homo sapiens
EAW52510	9.7e-170	99.7	interferon regu...	Homo sapiens
BAG37040	1.1e-169	99.7	unnamed protein...	Homo sapiens
XP_001115379	1.5e-156	94.6	interferon regu...	Macaca mulatta
ACC60989	7e-142	83.3	interferon regu...	Marmota monax

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001346	48	135	PD002355	Interferon regulatory factor
FPrintScan	IPR001346	45	64	PR00267	Interferon regulatory factor
	IPR001346	71	84	PR00267	Interferon regulatory factor
	IPR001346	88	105	PR00267	Interferon regulatory factor
	IPR001346	111	133	PR00267	Interferon regulatory factor
HMMPfam	IPR001346	45	150	PF00605	Interferon regulatory factor
HMMSmart	IPR001346	39	150	SM00348	Interferon regulatory factor
ScanRegExp	IPR001346	64	96	PS00601	Interferon regulatory factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp