Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01495
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01495
Clone name bm02364
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NCL
cDNA sequence DNA sequence (2676 bp)
Predicted protein sequence (745 aa)
Flexi ORF Clone FXC01495
Description Nucleolin (Protein C23).
Features of the cloned cDNA sequence

Length: 2676 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 437 bp
Genome contig ID gi89161199r_231927709
PolyA signal sequence
(ATTAAA,-19)		 
+----*----+----*----+----*----+----
AGCGGCTTTAGGACAAATTAAAAGTCAACTCTGGT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
GCCAGACGTGTTACTTCCTAAAGAGTGTTTCCCCTGGAATGTCACTGGAG

Features of the protein sequence

Length: 745 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001116949 3.5e-175 97.3 similar to nucl...
 Macaca mulatta
P19338 2e-170 100.0 Nucleolin; Prot...
 Homo sapiens
AAA59954 3.4e-169 99.5 nucleolin [Homo...
 Homo sapiens
Q5RF26 6.9e-169 99.0 Nucleolin.
 Pongo abelii
Q4R4J7 2e-168 98.7 Nucleolin.
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 379 413 PF00076 RNA recognition motif
IPR000504 430 496 PF00076 RNA recognition motif
IPR000504 523 590 PF00076 RNA recognition motif
IPR000504 609 677 PF00076 RNA recognition motif
HMMSmart IPR000504 343 414 SM00360 RNA recognition motif
IPR000504 429 497 SM00360 RNA recognition motif
IPR000504 522 591 SM00360 RNA recognition motif
IPR003954 522 591 SM00361 RNA recognition
IPR003954 608 678 SM00361 RNA recognition
IPR000504 608 678 SM00360 RNA recognition motif
ProfileScan IPR000504 342 418 PS50102 RNA recognition motif
IPR000504 428 501 PS50102 RNA recognition motif
IPR000504 521 595 PS50102 RNA recognition motif
IPR000504 607 682 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp