Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01496
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01496
Clone name bm02392
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PSMD3
cDNA sequence DNA sequence (2127 bp)
Predicted protein sequence (540 aa)
Flexi ORF Clone FXC01496
Description 26S proteasome non-ATPase regulatory subunit 3 (26S proteasome regulatory subunit S3) (Proteasome subunit p58).
Features of the cloned cDNA sequence

Length: 2127 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 378 bp
Genome contig ID gi51511734f_35290606
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATGATTTTTAAACAATAAAAAGTTCTCCACAGTG
Flanking genome sequence
(117134 - 117183)
----+----*----+----*----+----*----+----*----+----*
CTTTGTGCATCAGTTACTATACTTCACTGCAGTATTGGCAGGCTCAGATT

Features of the protein sequence

Length: 540 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43242 2.8e-191 100.0 26S proteasome ...
Homo sapiens
AAP36540 2.8e-191 100.0 proteasome (pro...
synthetic construct
BAA23651 5.5e-191 99.8 proteasome subu...
Homo sapiens
CAG33053 6.3e-191 99.8 PSMD3 [Homo sap...
Homo sapiens
XP_001094505 6e-190 99.4 proteasome 26S ...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000717 364 468 PF01399 Proteasome component region PCI
IPR013586 471 538 PF08375 26S proteasome regulatory subunit
HMMSmart IPR013143 227 399 SM00753 PCI/PINT associated module
IPR000717 399 489 SM00088 Proteasome component region PCI
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp