ORK01498

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01498

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01498
Clone name	bm02588
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	NEUROD1
cDNA sequence	DNA sequence (1801 bp) Predicted protein sequence (371 aa)
HaloTag ORF Clone	FHC01498
Flexi ORF Clone	FXC01498
Description	Neurogenic differentiation factor 1 (NeuroD1) (NeuroD).

Features of the cloned cDNA sequence

Description

Length: 1801 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	641 bp
Genome contig ID	gi89161199r_182150119
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTGTTGCCTTAGCACTTCTTTCCTCTCCAATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTGCACAATTTGAGCA

Features of the protein sequence

Description

Length: 371 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q13562	6.2e-114	100.0	Neurogenic diff...	Homo sapiens
AAV38535	6.2e-114	100.0	neurogenic diff...	synthetic construct
AAV38536	1.1e-113	99.7	neurogenic diff...	Homo sapiens
BAA11558	1.1e-113	99.7	NeuroD [Homo sa...	Homo sapiens
XP_001497909	1.1e-113	99.7	similar to neur...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	117	169	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	122	174	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	117	169	PS50888	Basic helix-loop-helix dimerisation region bHLH

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp