Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01499
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01499
Clone name bm02717
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol YBX1
cDNA sequence DNA sequence (1531 bp)
Predicted protein sequence (374 aa)
Flexi ORF Clone FXC01499
Description Nuclease sensitive element-binding protein 1 (Y-box-binding protein 1) (Y-box transcription factor) (YB-1) (CCAAT-binding transcription factor I subunit A) (CBF-A) (Enhancer factor I subunit A) (EFI-A) (DNA-binding protein B) (DBPB).
Features of the cloned cDNA sequence

Length: 1531 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 404 bp
Genome contig ID gi89161185f_42820672
PolyA signal sequence
(AATAAA,-22)		 
+----*----+----*----+----*----+----
GCAAGCACCTGTTAATAAAGGTCTTAAATAATTGT
Flanking genome sequence
(119940 - 119989)		 
----+----*----+----*----+----*----+----*----+----*
CTTTGTGTAAATTTGTCTAGTTTTGCTTTAGTTTGTAAGTATTTAGCTAT

Features of the protein sequence

Length: 374 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001088540 2.3e-114 100.0 similar to nucl...
 Macaca mulatta
XP_525693 2.4e-114 100.0 similar to DNA-...
 Pan troglodytes
AAA35750 1.1e-110 100.0 DNA-binding pro...
 Homo sapiens
XP_001136258 5.3e-109 98.6 similar to DNA-...
 Pan troglodytes
XP_001134851 2.6e-107 96.7 similar to DNA-...
 Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR002059 129 176 PD000621 Cold-shock protein
FPrintScan IPR002059 111 126 PR00050 Cold-shock protein
IPR002059 132 141 PR00050 Cold-shock protein
IPR002059 151 169 PR00050 Cold-shock protein
HMMPfam IPR002059 108 178 PF00313 Cold-shock protein
HMMSmart IPR011129 110 178 SM00357 Cold shock protein
ScanRegExp IPR002059 122 141 PS00352 Cold-shock protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp