ORK01516

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01516

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01516
Clone name	bm04652
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	HNRNPR
cDNA sequence	DNA sequence (2065 bp) Predicted protein sequence (658 aa)
HaloTag ORF Clone	FHC01516
Flexi ORF Clone	FXC01516
Description	Heterogeneous nuclear ribonucleoprotein R (hnRNP R).

Features of the cloned cDNA sequence

Description

Length: 2065 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	61 bp
Genome contig ID	gi89161185r_23409473
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCAAGATACGATTGGCTCTAGATCTACATTCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAATTGGCTTAACTGTTTCATCTTTAAGTAGCATTTTGCTGC

Features of the protein sequence

Description

Length: 658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001111802	7.7e-212	99.8	heterogeneous n...	Macaca mulatta
XP_513191	6.9e-211	99.8	similar to hete...	Pan troglodytes
O43390	1.4e-204	100.0	Heterogeneous n...	Homo sapiens
AAI33300	2.4e-204	99.8	HNRNPR protein ...	Bos taurus
CAH92794	2.4e-204	99.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	192	257	PF00076	RNA recognition motif
	IPR000504	273	334	PF00076	RNA recognition motif
	IPR000504	368	431	PF00076	RNA recognition motif
HMMSmart	IPR000504	191	265	SM00360	RNA recognition motif
	IPR000504	272	349	SM00360	RNA recognition motif
	IPR000504	367	432	SM00360	RNA recognition motif
HMMTigr	IPR006535	131	653	TIGR01648	HnRNP R and Q splicing factor
ProfileScan	IPR000504	190	269	PS50102	RNA recognition motif
	IPR000504	271	353	PS50102	RNA recognition motif
	IPR000504	366	436	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp