ORK01518

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01518

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01518
Clone name	bm05157
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	XRCC6
cDNA sequence	DNA sequence (2108 bp) Predicted protein sequence (613 aa)
HaloTag ORF Clone	FHC01518
Flexi ORF Clone	FXC01518
Description	X-ray repair complementing defective repair in Chinese hamster cells 6

Features of the cloned cDNA sequence

Description

Length: 2108 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	223 bp
Genome contig ID	gi89161203f_40247256
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTACTGCCTGAATAAAGAGCCCTAAGTTTGTACT
Flanking genome sequence (142734 - 142783)	----+--------+--------+--------+--------+----* ATATACTGTTCTTTTGTGTGAAGGAGAAAGGTGTGTATGCCTTGCATCCA

Features of the protein sequence

Description

Length: 613 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P12956	100.0	ATP-dependent D...	Homo sapiens
CAG47015	99.8	G22P1 [Homo sap...	Homo sapiens
BAG37986	99.6	unnamed protein...	Homo sapiens
BAE01402	99.1	unnamed protein...	Macaca fascicularis
CAH93208	99.1	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005161	41	260	PF03731	Ku70/Ku80
	IPR006164	265	472	PF02735	DNA helicase
	IPR005160	475	563	PF03730	Ku70/Ku80 C-terminal arm
	IPR003034	577	611	PF02037	DNA-binding SAP
HMMSmart	IPR006164	312	458	SM00559	DNA helicase
HMMSmart	IPR003034	577	611	SM00513	DNA-binding SAP
HMMTigr	IPR006165	28	612	TIGR00578	DNA helicase
ProfileScan	IPR003034	577	611	PS50800	DNA-binding SAP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp