ORK01521

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01521

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01521
Clone name	bm05308
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CTSB
cDNA sequence	DNA sequence (1929 bp) Predicted protein sequence (344 aa)
HaloTag ORF Clone	FHC01521
Flexi ORF Clone	FXC01521
Description	Cathepsin B precursor (EC 3.4.22.1) (Cathepsin B1) (APP secretase) (APPS) [Contains: Cathepsin B light chain; Cathepsin B heavy chain].

Features of the cloned cDNA sequence

Description

Length: 1929 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	811 bp
Genome contig ID	gi51511724r_11639232
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- CTGTGCCAATAAAAGGTTTCTCCAACTTGAAGTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTGATGGGATCTCAGATCCTTTGTCACTGCCTATAGACTTGTAGCTG

Features of the protein sequence

Description

Length: 344 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P07858	2.4e-155	100.0	Cathepsin B; Ca...	Homo sapiens
AAA52129	4.4e-155	99.7	preprocathepsin...	Homo sapiens
BAF82928	5.1e-155	99.7	unnamed protein...	Homo sapiens
AAH10240	9.4e-155	99.4	Cathepsin B [Ho...	Homo sapiens
AAP36125	9.4e-155	99.4	cathepsin B [sy...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000668	85	159	PD000158	Peptidase C1A
FPrintScan	IPR000668	107	122	PR00705	Peptidase C1A
	IPR000668	283	293	PR00705	Peptidase C1A
	IPR000668	298	304	PR00705	Peptidase C1A
HMMPfam	IPR012599	31	71	PF08127	Peptidase C1A
HMMPfam	IPR000668	85	334	PF00112	Peptidase C1A
HMMSmart	IPR000668	85	334	SM00645	Peptidase C1A
ScanRegExp	IPR000169	107	118	PS00139	Peptidase
	IPR000169	281	291	PS00639	Peptidase
	IPR000169	298	317	PS00640	Peptidase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp