ORK01543

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01543

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01543
Clone name	eh00685
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	NRG1
cDNA sequence	DNA sequence (5769 bp) Predicted protein sequence (596 aa)
HaloTag ORF Clone	FHC01543
Flexi ORF Clone	FXC01543
Description	neuregulin 1

Features of the cloned cDNA sequence

Description

Length: 5769 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3977 bp
Genome contig ID	gi51511724f_32425384
PolyA signal sequence (GATAAA,-18)	+--------+--------+----*----+---- TTTTCATATAAGTTTAAGATAAATGTCAAAAATAT
Flanking genome sequence (319380 - 319429)	----+--------+--------+--------+--------+----* ATGTTCTTTTGTTTTTCTTTGCTTTAAAATTATGTATCTTTTCCTTTTCT

Features of the protein sequence

Description

Length: 596 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAA19951	3.5e-148	100.0	neu differentia...	Homo sapiens
EAW63412	9.1e-148	99.7	neuregulin 1, i...	Homo sapiens
XP_858147	1.3e-142	96.1	similar to neur...	Canis lupus fam...
NP_001153476	3.1e-141	96.7	pro-neuregulin-...	Homo sapiens
ABY66350	7e-141	96.7	neuregulin 1 is...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002154	442	455	PR01089	Neuregulin 1-related
	IPR002154	463	474	PR01089	Neuregulin 1-related
	IPR002154	480	497	PR01089	Neuregulin 1-related
	IPR002154	508	518	PR01089	Neuregulin 1-related
HMMPfam	IPR013151	184	248	PF00047	Immunoglobulin
	IPR006209	316	355	PF00008	EGF-like
	IPR002154	369	596	PF02158	Neuregulin 1-related
HMMSmart	IPR003599	176	264	SM00409	Immunoglobulin subtype
	IPR003598	182	253	SM00408	Immunoglobulin subtype 2
	IPR006210	315	356	SM00181	EGF
ProfileScan	IPR007110	171	262	PS50835	Immunoglobulin-like
ProfileScan	IPR000742	312	356	PS50026	EGF-like
ScanRegExp	IPR013032	344	355	PS00022	EGF-like region
ScanRegExp	IPR013032	344	355	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	377	VLTITGICIALLVVGIMCVVAY	398	PRIMARY	22