ORK01545

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01545

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01545
Clone name	ej00427
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TRAF6
cDNA sequence	DNA sequence (3572 bp) Predicted protein sequence (551 aa)
HaloTag ORF Clone	FHC01545
Flexi ORF Clone	FXC01545
Description	TNF receptor-associated factor 6 (Interleukin 1 signal transducer) (RING finger protein 85).

Features of the cloned cDNA sequence

Description

Length: 3572 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1790 bp
Genome contig ID	gi51511727r_36366174
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TTTTACAATGAATAAATAATTGTCAAGTTCCATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAACTGAACAGTAGTATTTTTGTATTTGCGTAGAAAAAGCCTGAAGGA

Features of the protein sequence

Description

Length: 551 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y4K3	0	100.0	TNF receptor-as...	Homo sapiens
AAH31052	7.6e-217	99.8	TNF receptor-as...	Homo sapiens
XP_001154065	8.8e-217	99.6	TNF receptor-as...	Pan troglodytes
XP_001114764	3e-214	98.0	similar to TNF ...	Macaca mulatta
AAH60705	9e-195	87.9	TNF receptor-as...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	99	137	PF00097	Zinc finger
	IPR001293	180	231	PF02176	Zinc finger
	IPR001293	233	288	PF02176	Zinc finger
	IPR002083	386	530	PF00917	MATH
HMMSmart	IPR001841	99	137	SM00184	Zinc finger
HMMSmart	IPR002083	384	511	SM00061	MATH
ProfileScan	IPR001841	99	138	PS50089	Zinc finger
	IPR001293	180	221	PS50145	Zinc finger
	IPR001293	233	287	PS50145	Zinc finger
	IPR002083	379	528	PS50144	MATH
ScanRegExp	IPR001841	114	123	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp